TPS37

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableCOILSCoilCoilcoord: 43..47
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..31
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 32..51
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 13..562
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 13..562
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 24..208
e-value: 5.3E-48
score: 163.3
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 23..545
e-value: 1.2E-189
score: 632.9
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 235..561
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 240..505
e-value: 9.7E-94
score: 313.6
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 60..234
e-value: 1.2E-189
score: 632.9
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 20..231

TPS37
Sequences
Sequence
AGTACTACAATATTCAAAGAACAACCGGAAGCAATTGTCCGACGATCAGG
AAACTACAAACCCACGTTGTGGGATGCTCATTTTTTCAAATCACTCCAAG
TCATATATACGGAGGAAAGCTATGGGAAAAGAATCAATGAGCTGAAAGAA
GATGTGAGAAGAATTCTTGAGAAGGAGGCTGAGAATCCTTTAGTTAAACT
TGAACAGATCAATGATTTGAGCAGACTTGGAATATCTTATCACTTTGAAG
ATCAAATTAAGACAATATTAAACCTGACATTTAACAATAATAATGCATTG
TGGAAGAAAGATAATCTGTATGCCACTGCTCTTCATTTCAAACTCCTTAG
ACAATATGGATTCAATCCTGTATCTTCAGAGGTTTTCAATGCCTTCAAAG
ACCAGAAAAAAGAGTTCAAAGAAAGTTTGAGTAAGGATGTGAAAGGAATG
GTATGTCTATATGAGGCTTCATTCTATTCATTTAGGGGTGAACCCATATT
AGATGGAGCAAGAGACTTCACAACCAAACATCTGAAACAATACTTGATGA
CGAGGCAATGTCAAACTAAATCTGTTGACCATGATGATGATGATGATCTT
GTGAAACTTGTGGAGCATGCCTTGGATCTTCCACTCCATTGGAGATTGCC
AAGATTGGAGGCTAGGTGGTTCATTGATATGTATGCTGAAAGGAATTATG
ATATGAATCCAACTTTTCTTGACTTCGCTAAACTTGACTATAACTTCGTT
CAGTCAGCATACCAAAAAGAGCTCAAATATATTTCAAGGTGGTGGAGTGG
TTCTAGGTTGACAGAAAGGCTACCATTTGCTAGAGACAGAGTAGTGGAAA
TTTTCTATTCTGCAGTGGCATTAAAATATGAGGCAGAATTTGGATTTGTT
AGAACTGTGATGACAAAAATTGGTCTCTTGCTAACACTCATGGACGATAT
ATATGATGTGTATGGTACACTAGATGAGCTTCAGCTTTTTCTAGGGGCAA
TTGAGAGGTGGAATATAAATGAATTGGATCAGCTACCCGATTACATGAAG
ATATTGTTTGTTGCTTTTTATAACAATGTGAATGAGATATCTTATTATGT
CCTTAAAGAAAATGGGATTCACATCATCAAATATCTGAAGAAAGCGTTGG
GGGATCTGTGTAAATGCTATATGGAGGAGGCAAAATGGTTTCACAGTGGA
CACATACCAAGTTTAGAAGAATTCATTGAGAATGGATGGAAATCAATTAC
AATACCTCTTTGTCTTATCTATCATTATTGCTTAATTACAACTTCAATTA
CAGAACAAGACATGGAACACTTGCTTCAATATCCAACTATTTTACGTGTC
TCAGGAACTGTCTTTCGATTTATAGATGATTTGGGAACCTCATCAGATGA
ACTTGAAAGAGGAGATAATCCTTCATCAATTCAATGCTACATGCGTGAAA
AGGGTGTTAGTGAAAATGAAAGCCGTGAACACATATGGAATTTAATAAGT
GAAGGATGGAAGGAAATTAATGAAGTCAAAGCTTCAAACTCTCCATACTC
TCAAGTGTTTATTGAATCTGCCATTGATTTTGTTAGAGGAGCAATGGAGA
TGTATCACAAGGGTGATGGCTTTGGTACTAATCAAGACCGATATCTTAAG
ACCAAAGTTGTCAACATGTTCTTCGATCCAATTCCAATT
Sequence Length
1689
Sequence Checksum
c2e493596e26c93c173ab99b69ad72de
Summary
Resource Type
mRNA
Organism
Name
TPS37
Identifier
TPS37
Time Accessioned
Friday, October 21, 2022 - 20:04
Time Last Modified
Friday, October 21, 2022 - 20:04