TPS44

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..24
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 25..35
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 36..59
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 60..63
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 3..528
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 3..528
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 28..53
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..27
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 207..528
e-value: 4.6E-106
score: 356.4
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 192..528
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 4..166
e-value: 4.1E-46
score: 157.1
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 197..475
e-value: 1.8E-93
score: 312.7
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 6..206
e-value: 3.0E-63
score: 214.8
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 11..190

TPS44
Sequences
Sequence
AATAACAAAGAGAGTTATGTGAAGATTATTGAGCTGAAGGAACAAGTGAA
GAATAAATTACTTCATGGTCTTCATCCTTTGGAAAACCCTTTAGAGACAC
TTGAATATATTGATGATATTCAACGATTGGGGTTATCTTATTATTTCGAA
AATGAAATTGAACAAGTTTTGAAGCAATTTCATAATAATAACAATCTTCA
TCACGATTTTGGTGATAACCTTTATGCTGATGCTCTTCGCTTTCGGTTGC
TTAGGGAACAAGGTTATAATAGTGCATGTGAGGTATTCGCCAAATATAAG
AATGAGAGAGGAAAATTTAAGGAATCAATTTTGAGTGACATTCGAGGAAT
GTTGAACTTGTATGAAGCTTCACAAATGAGAGTTTGCAGAGAAAAAATAC
TAGATGAAGCACTTATCTTCACAACTACTCATCTTCAGTCCTTAGTGGAA
ACATCCCAATTGAGCTCTCCTTATTTAGACCTAGTGAAACATGCCCTAAT
GCACCCTATTCGAAAGAGCTTACAAAGAAGAGAGGCAAGACTTTACATAT
CACGTTACCACCAACTACCTTCTCACGAAAAGCTTCTTTTAACTCTTGCC
AAACTAGATTTCAACTTGCTTCAACAACTACATCAAAAAGAATTAAATTA
TATTACGAGGTGGTGGAAGGAGTTTGACTTCAAAAGTAAGCAATCTTTTT
CAAGAGACAGAATAGTGGAGTGTTACATTTGGAATTATGGAGTATATTTT
GAAGCTCAAACTTCCCAAATTAGGTTGATGATGACCAAGTTGATTTCTTT
GCTTACTATTATTGATGATTCTTATGATAGCTATGGTACACTTGAAGAGC
TAAGGCCTTTTACTGAAGCAGTTAGAAAGGTATTTAATTATATATACAAA
CATATGAAGTGGGATATATCTGCTACTGAAAATTTACTAGAGTACATGAA
AGTATGTTACAAGAAATTTTTAGAATTTTTCAATGAAATTGAAGAATTTA
CAAAGGAAAATCCATACTGTGCGAGCTATGTTAAGAAAGGGTTGCAATGT
ATGGTTAGAGCTTATAGTAAGGAAGCCCAATGGTTACACAATAAATATAT
GCCAACATTTGATGAATATTATCCAATTGGACTTGATAATGCTGGATCTG
ATGAGCTAATATCAATGGCCTTTTGTGGAATGGGAAATGTTGTAACAAAA
GAATCTATGGATTGGATATTTTCTCAACCCCAACCTAAGATTATACGAAC
TATGTCAATTGTTGGAAGACTTATGAATGACATTGGCTACCACAAGTCGG
ATCGAAGAAAATTATCAAAAGATGTAGTGGCTTCCGCTGTGGAGTGTTAC
ATCAAACAATATGGTGTAACAGATGAAGAAGCTATAGAGAAACTTAACGA
ACAAGTTAATGATTCATGGAAGGATCTCAATGAAGATCTTCTTTATCCAA
TCGCTATTCCTAGACCACTCTTAATGAGAGTTCTCAATCTTGTACGAGTG
AACCATGAGATGTATAGAGAAGGCGACGGTTTTACACAACCAACATTGCT
CAAGAATTTGATTGATACTCTCATCATCAATCCC
Sequence Length
1584
Sequence Checksum
e290100fa964b16e78da1e177715177f
Summary
Resource Type
mRNA
Organism
Name
TPS44
Identifier
TPS44
Time Accessioned
Friday, October 21, 2022 - 17:54
Time Last Modified
Friday, October 21, 2022 - 17:54