TPS55

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 24..43
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 44..113
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..23
NoneNo IPR availableTMHMMTMhelixcoord: 26..43
NoneNo IPR availableTMHMMTMhelixcoord: 5..22
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 2..524
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 2..524
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..16
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 17..35
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 36..60
NoneNo IPR availableTMHMMTMhelixcoord: 10..32
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..23
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 24..46
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 47..73
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 9..195
e-value: 4.1E-55
score: 188.0
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 196..523
e-value: 5.1E-125
score: 418.7
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 198..524
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 203..469
e-value: 4.3E-102
score: 341.0
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 3..172
e-value: 3.6E-51
score: 173.6
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 26..198

TPS55
Sequences
Sequence
CAACAACAAAAGGTTGAGGAATTAAAAGAGGTGATTAGAAGAGAAATATT
TGGGGAATCATCAATATCATCATCAGCTTATTATGATGCTTGGAAAAATC
AATTGAAGATAATTGATGTGGTAGAACGTTTGGGATTGTCTTATCATTTT
GAAACTGAAATAGAAAATATGATAGAACAAATCTACAACAAAACCAATAA
TTTTGATCTTCTTAAGGATGAAGAGTTGCATGATGTTTCCTTGTGGGTTA
GACTTCTACGACAACATGGATTTAGGGTTTCTTCTGATATATTTAAAAAA
TTCAAAGATGAGGATGGAAACTTTAAAAAATGTTTGGTAAGTGATACTCT
TGGTTTGCTTAGCTTATATGAAGCCTCACATTTGAGTTGTGTTGGAGAAA
ATATACTTGATGAAGCACTTGCTTTCACAACAACACACCTAAATGAGTTT
TTGGCGAAGAAAAAAGAACACCATGATGACGATGATCCATTATCGAAAGA
AATATATCGTGCCCTAGAGAGGCCCTTAAGAAAGACCCTAGTGAATCTTC
ATACTAAGCATTTCATTTCGATATATGAAAAAGATGCCTCACATAACAAA
GTATTGCTACAACTTGCAAAGTTAGATTTTAATCTATTACAATCCCTACA
CAAAAAGGAGCTTAGTGAAATCAGCAGGTGGTGGAAAGAATCAAACTTTG
TACAAAAATTCCCTTTTGCAAGAGATAGAATTGTGGAGCTCTATCTGTGG
ATGTTAGGAGTCTATTATGAACCCCAATACTCTTTGGCAAGAAATATTTT
AGCCAAAATCATAGCTTTTTCCTCAATTGCTGATGATATTTATGATGCAT
ATGGTACATTTGAAGAGCTTGAACTCCTAACTCAAGCAATTGAAAGGTGG
GATATAAATTGTATTGATACACTCAATCAAGAATATTTGAAAACATTTTA
TAAGGATCTTTTGAATTGTTATGAAGAGTTTGAGCAAGTGCTTACAAAAG
AAGAAACTTATAGAGTTCATTATGCAAAAGAAGTGTTTAAAGAGTTAATC
CGATCATATTTTGATGAAGCTCGATGGTTGAATAGTGGACGTGTCCCAAA
TTTTGAAGAGTACATGGAATTTGCAACCATTAATTGTGGTTACTATATGT
TGATAGTGAGTTCTTTGGTTGGAATAAAAACTAGTATTGTAACCAAAGAT
GTTTTTGAGTGGCTCTCCAAAGATCGAAAGATTATTAGAGCATCTGTTAT
TATTTGTAGGCTCATGGATGACATAGCTGAACACAAGTTTGAGAAAGACA
AATATGATGAAGATTCTGCCATTGAATCGTATATGATGCAACATGGTGTT
TGTGAAGAAGAAGCCTATGATGAACTCAATAAGCTTATAATTAATTCATG
GAAAGAAATAAATGAAGAGTTTTTGAAGCCAACTAAATTAGCTTCACCCA
TATTACTTAGGGTTCTTAATTTTTCTAGGGTTATGGATCTTCTCTACAAA
AATGGTGATGGTTTTACACATGTTGGAAAAGTCACCAAAGATACTGTTGC
TGCTTTGCTAATTGATCCCATT
Sequence Length
1572
Sequence Checksum
08f60dff8bfbe9aabb8cf666cb9f46ee
Summary
Resource Type
mRNA
Organism
Name
TPS55
Identifier
TPS55
Time Accessioned
Friday, October 21, 2022 - 20:04
Time Last Modified
Friday, October 21, 2022 - 20:04