TPS42

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..26
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 27..41
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 43..43
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..42
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 34..53
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 54..54
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..33
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 39..42
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..38
NoneNo IPR availableTMHMMTMhelixcoord: 15..37
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..35
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 36..54
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 55..55
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 32..46
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 7..31
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..6
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..26
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 27..44
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 45..52
NoneNo IPR availableTMHMMTMhelixcoord: 27..44
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 21..570
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 21..570
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 31..555
e-value: 1.4E-193
score: 645.9
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 244..571
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 68..240
e-value: 1.4E-193
score: 645.9
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 248..514
e-value: 2.0E-97
score: 325.7
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 32..214
e-value: 5.8E-47
score: 159.9
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 29..240

TPS42
Sequences
Sequence
TCAAGTACTTGCTACCCCATCAAATGTTCTGTGGTCCATAACCCTAGTTC
TACTACTATTGTTAGAAGATCAGGAAACTATGAACCTCCCATTTGGTCTT
TTGATTATATTCATTCTCTTTCAAGCAAATATAAGGGAGAAGCTTATACA
AATCGACTGAAAAAGCTTGAGAAAGATGTGAAAATGATGCTACTTGGCAT
GGAAATTAATTCTTTAGCCCAACTTGAGTTCATTGATACATTACAAAGGC
TTGGAATATCTTATCATTTTAAAAATGAAATAAATACTATTTTAAAGAAA
AAATACACTAATAATACAAATATTATGAATAAAAACCCTAACTATGACTT
ATATGCCACTTCTTTGGAATTTAGGCTTCTACGGGAGTATGGATTTGTAG
TACCTCAAGAAATTTTCAATGATTTTAAGGATGATGAAACAGGAGAGTTC
AAGGCAACTATAAATGATGATATTATGGGAGCATTGGCTTTATATGAAGC
TTCATTTTATGGGAAAAATGGTGAAAGTGTTTTGGAAGAAGCAAGAATTT
TCACAACCAAATGTCTTGAAAAATACAAAATATTGTCAAGTGATAATAAT
AATAATAATAATAATATATTATTATTAGTGGATCATGCTTTGGAAATGCC
ACTTCATTGGAGAATCACAAAATCAGAAGCTAGATGGTTCATTGAAGAAA
TATATGAGAAAAAACAAGACATGATGATGAATTCTACTTTGCTTGAGTTT
GCCAAATTGGATTTCAACATTGTGCAATCAACATATCAAGAAGAGCTCAA
ATATCTCTCTAGGTGGTGGAAGCATTCTAAACTTGGAGAGAAATTGCCTT
TCGTTAGAGATAGATTGATGGAGTGTTTCATGTGGCAAGTTGGAATAAGA
TTTGAGCCAGAATTCAGTTACTTTAGAATAATTGCTACACAAATCTATGT
TCTAATCACAATAATTGATGATATGCATGACATATATGCAACTTTGGAGG
AACTACAACTCTTCGCTAATGCTCTTCAAAGGTGGGATTTGAAAGTAATA
GATGAGTTACCGGATTACATGAAGATGGCTTTCTTCATTTTATACAATTT
CACAAATGAAATGGTGTTTAATGTATTAGGAGAACATGGTTTTGTTAACC
TTGAATACTTCAAGAAATTGTGGATAGACATATGTAAACATCAATTGCAA
GAGGCAAAATGGTTCTATAGTGGATACCAACCAACATTGCAAGAATATAC
TGAAAATGCTTGGATTTCAGTAGGAGGACCAGCTTTTCTTATGCATGCTT
ATTTCTGTTTTACAAATCTCATAACAAATGAAGAAGTGGAATGTCTTAAA
GAGGGTTATCCCAATATTGTTCGACATGGATCCCTAATATTACGACTTGC
AGATGATCTAGGAACATGTTCGGATGAAATGAAAAGAGGCGATGTTCCTA
CATCAATTCAATGTTACATGCATGATACTGGTGTTTCTGAAGACGAAGCT
CGTGAGCACATCAAGCATTTGATAAGCGAATCATGGAAGGAGATGAATAA
TGAAAATGGAGATCATAATTCTTCTTTCTCGAAAGAATTTGTTCATGTTT
GCAAAAATCTTGGTAGAGCGTCACAATTTATATACCAATATGGAGATGGA
CATGCTTCTCAAAATACTCTATCAAAAGATCGTATTTTTAAAATTATTAT
TAATCCTTTCCCC
Sequence Length
1713
Sequence Checksum
ea6faf74873b2032eb5458748a8fd712
Summary
Resource Type
mRNA
Organism
Name
TPS42
Identifier
TPS42
Time Accessioned
Friday, October 21, 2022 - 20:04
Time Last Modified
Friday, October 21, 2022 - 20:04