MK801766.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..26
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 27..66
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 76..621
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 76..621
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 30..60
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..29
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 29..53
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..28
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 86..605
e-value: 2.4E-195
score: 651.7
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 294..622
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 87..266
e-value: 1.9E-46
score: 158.2
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 298..564
e-value: 2.2E-99
score: 332.2
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 123..292
e-value: 2.4E-195
score: 651.7
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 84..292

  • Cannabis sativa isolate CsTPS14CT (-)limonene synthase mRNA
  • complete cds
Sequences
Sequence
ATGCAGTGCATAGCTTTTCACCAATTTGCTTCATCATCATCCCTCCCTAT
TTGGAGTAGTATTGATAATCGTTTTACACCAAAAACTTCTATTACTTCTA
TTTCAAAACCAAAACCAAAACTAAAATCAAAATCAAACTTGAAATCGAGA
TCGAGATCAAGTACTTGCTACCCCATACAATGTACTGTGGTCGATAACCC
TAGTTCTACGATTACTAATAATAGTGATCGAAGATCAGCCAACTATGGAC
CTCCCATTTGGTCTTTTGATTTTGTTCAATCTCTTCCAATCCAATATAAG
GGTGAATCTTATACAAGTCGATTAAATAAGTTGGAGAAAGATGTGAAAAG
GATGCTAATTGGAGTGGAAAACTCTTTAGCCCAACTTGAACTAATTGATA
CAATACAAAGACTTGGAATATCTTATCGTTTTGAAAATGAAATCATTTCT
ATTTTGAAAGAAAAATTCACCAATAATAATGACAACCCTAATCCTAATTA
TGATTTATATGCTACTGCTCTCCAATTTAGGCTTCTACGCCAATATGGAT
TTGAAGTACCTCAAGAAATTTTCAATAATTTTAAAAATCACAAGACAGGA
GAGTTCAAGGCAAATATAAGTAATGATATTATGGGAGCATTGGGCTTATA
TGAAGCTTCATTCCATGGGAAAAAGGGTGAAAGTATTTTGGAAGAAGCAA
GAATTTTCACAACAAAATGTCTCAAAAAATACAAATTAATGTCAAGTAGT
AATAATAATAATATGACATTAATATCATTATTAGTGAATCATGCTTTGGA
GATGCCACTTCAATGGAGAATCACAAGATCAGAAGCTAAATGGTTTATTG
AAGAAATATATGAAAGAAAACAAGACATGAATCCAACTTTACTTGAGTTT
GCCAAATTGGATTTCAATATGCTGCAATCAACATATCAAGAGGAGCTCAA
AGTACTCTCTAGGTGGTGGAAGGATTCTAAACTTGGAGAGAAATTGCCTT
TCGTTAGAGATAGATTGGTGGAGTGTTTCTTATGGCAAGTTGGAGTAAGA
TTTGAGCCACAATTCAGTTACTTTAGAATAATGGATACAAAACTCTATGT
TCTATTAACAATAATTGATGATATGCATGACATTTATGGAACATTGGAGG
AACTACAACTTTTCACTAATGCTCTTCAAAGATGGGATTTGAAAGAATTA
GATAAGTTACCAGATTATATGAAGACAGCTTTCTACTTTACATACAATTT
CACAAATGAATTGGCATTTGATGTATTACAAGAACATGGTTTTGTTCACA
TTGAATACTTCAAGAAACTGATGGTAGAGTTGTGTAAACATCATTTGCAA
GAGGCAAAATGGTTTTATAGTGGATACAAACCAACATTGCAAGAATATGT
TGAGAATGGATGGTTGTCTGTGGGAGGACAAGTTATTCTTATGCATGCAT
ATTTCGCTTTTACAAATCCTGTTACCAAAGAGGCATTGGAATGTCTAAAA
GACGGTCATCCTAACATAGTTCGCCATGCATCGATAATATTACGACTTGC
AGATGATCTAGGAACATTGTCGGATGAACTGAAAAGAGGCGATGTTCCTA
AATCAATTCAATGTTATATGCACGATACTGGTGCTTCTGAAGATGAAGCT
CGTGAGCACATAAAATATTTAATAAGTGAATCATGGAAGGAGATGAATAA
TGAAGATGGAAATATTAACTCTTTTTTCTCAAATGAATTTGTTCAAGTTT
GCAAAAATCTTGGTAGAGCGTCACAATTCATGTATCAGTATGGCGATGGA
CATGCTTCTCAGAATAATCTATCGAAAGAGCGCGTTTTAGGGTTGATTAT
TACTCCTATCCCCATGTAA
Sequence Length
1869
Sequence Checksum
163aab1f9b5b00dc6d7bf70bd66613b3
Summary
Resource Type
mRNA
Accession
MK801766.1
Organism
Name
MK801766.1
Identifier
MK801766.1
Time Accessioned
Friday, October 21, 2022 - 20:03
Time Last Modified
Friday, October 21, 2022 - 20:03