TPS59

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 34..52
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 23..33
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..22
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 53..58
NoneNo IPR availableTMHMMTMhelixcoord: 2..21
NoneNo IPR availableTMHMMTMhelixcoord: 31..53
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 8..18
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..7
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..23
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 19..23
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 24..75
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..20
score: 0.759
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 14..52
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..13
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..1
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 9..13
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 2..8
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..17
score: 0.69
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..23
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 46..48
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 24..45
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 12..16
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 17..55
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..3
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 4..11
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..16
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 25..55
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 7..24
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..6
NoneNo IPR availableTMHMMTMhelixcoord: 2..24
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 9..559
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 9..559
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 27..207
e-value: 7.2E-55
score: 185.7
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 66..232
e-value: 5.6E-183
score: 610.9
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 238..504
e-value: 4.5E-97
score: 324.6
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 27..543
e-value: 5.6E-183
score: 610.9
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 233..559
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 24..233

TPS59
Sequences
Sequence
ATGTTCACACAAATCTTAGTATCTTCAAATGACAACCCAAATATAATTGT
TCGTCCTACAAAAAAATTCCACCCAAATATTTGGGGAGAACGATTCTTAC
ATTACAACATTTCACAACAAGATTTGTATTGTCAACAACAAAAGGTTGAG
GAATTAAAAGAAGTGGTTAGAAGAGAAATATTTGGAGATTATTATTATGA
TGCTTGGAAAAATCAATTGAAGATAATTGATGTGGTAGAACGTTTGGGAT
TGTCTTATCATTTTGAAACTGAAATAGAAAATAAGCTTCAATGCATTTAC
AACAAAACTAATATTATTGATGATGAAGATTTACACCATGTTTCTATTCG
ATTTAGACTTCTACGACAACATGGATTTAGAATTTCTTCTGATATATTTG
AAAAATTCAAAGACGAGGATGGGAACTTTAAAAAATGCTTGGTAAGTGAT
ACCTTTGGTTTGCTTAGCTTATATGAAGCCTCACATTTGAGTTGTGTTGG
AGAAAATATACTTGATGAAGCACTTGCTTTCACAACAACACACCTAAATG
AGTTTTTGGTGAAGAAAAAAGAACACCATGAAGACGATGATCCATTATCG
AAAGAAATATCTCGAGCCCTAGAGAGGCCCTTAAGAAAGACCCTAGTAAA
TCTTCATGCAAGGCATTTCATTTCGATATATGAAAAAGATGCCTCACATA
ACAAAGTATTGTTACAACTTGCAAAATTAGATTTCAATCTATTACAATGC
ATGCATAAAAAGGAACTTAGTGAAGTCAGCAGGTGGTGGAAAGAATCAGA
TTTTGTACACAAATTTCCATTTGCAAGAGATAGGATTGTGGAATTATACC
TTTGGATATTAGGAGTTTATTATGAACCCCAATATTGTTTGGCAAGAAAT
ATTTTAGTCAAAATCATAGCTTTGGCCTCAATTGCGGATGATATTTATGA
TGCATATGGTACACTTGAAGAACTTGAGCTCCTAACTCATGCAATTGAAA
GGTGGGATATAAATTGTGTGGATACACTGAATCAAGAATATATGCAAACA
TTTTATAAGGATGTTTTGAATTGTTATGAAGAGTTTGAGCAAGTGCTAGA
AAAAGAAGAACAATACAAAGTTCATTATGCAAAAGCAGCGTTTAAGGGAT
TAGTCCGATCTCATTTGGATGAAGCTCGATGTTTGCATAGAGGACTCATC
CCAAGTTTTGAAGAGTACTTGAAATTTGCTTTGGATAATTGTGGTTACTA
CATGTTGATACTAAGCTCTTTGGTTGGAATGAAAACTAATATTGTAACAA
AAGATGTTTTTGAGTGGCTCTCCAAAGATCGAAAGATTATTAGAGCATCT
GTTACTATTTGTAGGCTCATGGATGACATAGCTGAACACAAGTTTGAGGA
AGATGATTATGAGGAACATTCAGCAGTGGAATGCTATATGATTGAACATG
GCGTTTGTGAAGAGGAAGCCTATGATGAACTGAATAAGCTAATAATGAAT
GCATGGAAAGAAATAAATGAAGAGTTTTTGAAGCCTACTAAAGTAGCTTC
ACCCATATTACTTCGTGCTCTTAACTTTTCAAGGGTTATGGATCTTATTT
TCAAATTTGGAGATGGTTATACACACGTTGGAAAAGTCACCAAAGATATT
GTTGCTGCTTTGCTTATTCATCCAATT
Sequence Length
1677
Sequence Checksum
f6b8f96779622a994ba1fe1b937949dc
Summary
Resource Type
mRNA
Organism
Name
TPS59
Identifier
TPS59
Time Accessioned
Friday, October 21, 2022 - 20:03
Time Last Modified
Friday, October 21, 2022 - 20:03