MK801765.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..21
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 22..41
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 42..54
NoneNo IPR availableTMHMMTMhelixcoord: 20..39
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 31..43
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..30
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..26
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 27..58
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 57..87
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 5..16
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 22..36
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..21
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 37..56
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 17..21
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..4
NoneNo IPR availableTMHMMTMhelixcoord: 37..56
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..31
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 32..50
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..14
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 15..36
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 37..42
NoneNo IPR availableTMHMMTMhelixcoord: 15..37
NoneNo IPR availableCOILSCoilCoilcoord: 240..260
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 69..630
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 69..630
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 477..495
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 496..633
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..476
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 307..574
e-value: 1.5E-94
score: 316.3
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 79..614
e-value: 3.8E-196
score: 654.4
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 301..629
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 116..300
e-value: 3.8E-196
score: 654.4
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 80..250
e-value: 1.8E-48
score: 164.8
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 77..300

  • Cannabis sativa isolate CsTPS15CT beta-myrcene synthase mRNA
  • complete cds
Sequences
Sequence
ATGCATTGTATGGCTGTTCACCAATTTTCTCCATCAATAGTATCATCACT
ACCTACCATTAGTACTTATAATAATAATCACTTTTGTAGATTTTTCACAC
CAAAAACATCTATTAGTCCTATTTCAAAAACAAAATCAAAATCAAGCACT
TGCTATCCCATCCAATGTACTGTGGTCAATAATAGTAGCCCTAGTTCTAC
TATTGTTCGAAGATCGGCCAATTATGAACCTCCGATTTGGTCTTTCGATT
ACATTCAATCTCTTTCAACCCAATATAAGGGAGAATCCTACACTAGGCAA
TTAAATAAGTTGAAGAAAGAAGTGACAAGAATGCTCCTTGGACTGGAAAT
TAACTCTTTAGCCCTACTCGAGCTAATTGATACATTGCAAAGGCTTGGAA
TATCTTACCATTTTAAGAATGAAATAAACACTATTTTGAAGAAAAAATAC
ACTGATAATTATATTAACAATAATAATATTATTACTAACCCTAATTATAA
TAATTTATATGCCATTGCTCTCGAATTTAGGCTTCTACGCCAACATGGCT
ATACAGTACCTCAAGAAATTTTTAATGCTTTCAAGGATAAGAGAGGGAAA
TTTAAAACATGCTTGAGTGATGATATTATGGGAGTATTGTGTTTATATGA
AGCTTCATTCTATGCTATGAAACATGAGAATATTTTGGAGGAAACAAGAA
TTTTTTCAACTAAATGTCTTAAAAAATACATGGAGAAAATGGAGAATGAG
GAAGAGAAAAAAATATTATTATTAGATGATAATAATATTAATAGTAATTT
GCTATTAATTAATCACGCTTTCGAGCTTCCGCTTCATTGGAGAATAACAA
GATCGGAAGCTAGGTGGTTCATTGACGAAATATATGAGAAAAAACAAGAC
ATGAATTCGACTTTGTTCGAGTTTGCGAAATTAGATTTTAATATAGTGCA
ATCAACACACCAAGAAGATTTACAACATTTATCGAGGTGGTGGAGGGATT
GTAAACTTGGTGGGAAATTGAATTTTGCTAGAGATAGATTGATGGAAGCT
TTCTTATGGGATGTTGGACTAAAATTCGAGGGAGAATTCAGCTATTTTAG
AAGAATAAATGCAAGATTATTTGTGCTTATAACAATAATTGATGATATTT
ATGATGTATATGGAACTTTGGAGGAATTAGAGCTTTTCACTAGTGCTGTT
GAAAGATGGGATGTGAAATTAATCAATGAGTTACCAGATTACATGAAGAT
GCCTTTCTTTGTTTTACACAATACCATAAATGAGATGGGGTTCGATGTAT
TAGTACAACAAAACTTTGTCAACATTGAATACCTTAAGAAATCGTGGGTA
GATTTATGTAAATGTTATTTACAAGAAGCAAAATGGTATTATAGTGGATA
CCAACCAACATTGGAAGAATACACTGAGTTGGGTTGGCTTTCAATAGGAG
CATCAGTAATTCTTATGCATGCTTATTTTTGTTTAACAAATCCTATAACA
AAACAAGACTTGAAAAGCTTGCAATTACAACATCATTATCCCAACATAAT
TAAACAAGCATGCTTGATTACAAGGCTTGCAGATGATTTAGGAACATCTT
CGGATGAATTGAATAGAGGCGACGTTCCTAAATCGATTCAATGTTACATG
TACGATAATAATGCTACAGAAGACGAAGCTCGTGAACACATCAAGTTCTT
GATAAGTGAAACATGGAAGGATATGAATAAGAAAGATGAAGATGAGAGTT
GTTTATCAGAAAATTTTGTTGAAGTTTGCAAAAATATGGCTAGAACAGCA
CTATTCATATATGAGAATGGAGATGGACATGGTTCTCAGAATAGTTTATC
AAAAGAACGTATTTCAACCTTGATTATTACTCCAATTAATATTCCTAAAT
AA
Sequence Length
1902
Sequence Checksum
64eec7113aaa9d5cb8a7011083b53819
Summary
Resource Type
mRNA
Accession
MK801765.1
Organism
Name
MK801765.1
Identifier
MK801765.1
Time Accessioned
Thursday, October 20, 2022 - 13:59
Time Last Modified
Thursday, October 20, 2022 - 13:59