MK801764.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 34..53
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..33
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 54..72
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 48..51
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..51
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 52..71
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 40..47
NoneNo IPR availablePANTHERPTHR31225:SF99coord: 48..554
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 48..554
NoneNo IPR availableCOILSCoilCoilcoord: 54..55
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 60..538
e-value: 1.6E-167
score: 559.9
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 238..545
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 239..503
e-value: 2.6E-86
score: 289.3
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 61..232
e-value: 1.6E-167
score: 559.9
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 56..192
e-value: 3.9E-40
score: 137.6
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 62..231

  • Cannabis sativa isolate CsTPS18VF (E)-nerolidol/( )linalool synthase mRNA
  • complete cds
Sequences
Sequence
ATGGCGTTGTCAATAATGTCTTCTTACGCATCTTTTCGTCCCTTTAAACC
CTCCTCATCACTTTCGAGTTCTCAAAACATAATTAGAAATTTTGACGAGA
ACTCCAAATATCATATCAGGAGTAACGGTGATCTCACACCACAAAAGGAT
TTAGATAAATACAGGGACGTTTTAAGAAAAGCAGACCCATTTGATGAAGG
TCTGAAGATGATTGATGCTATTCAACGGCTAGGAATTGACTATATCTTCG
AGGAAGAGATTGATAAAATTATACAAAGCCAGTCTGCTTATAAGTTTTTT
AGAGAATTCGAGCATGATCATCATCATCATCAAGATCTGTATGATGTAGC
TCTTCGTTTTCGACTCTTGAGACAACACGGTCTCTTCGTTCCTGCTGATA
TTTTCAACAAGTACAAGGACAATAATAAGGGTTGTTTCGACACAAGGCTA
AGAGAGGACATCAAGGGTTTGCTGAGCTTATATGAAGCCTCCCATCTATG
CATAGAGGGAGAAAATATCCTTGATGAAGCTGCTTTATTTAGTGCTCAAC
ACTTGGAAGCGTCCATGACACGTCTTCATCGTTATGATCAATATCAGGCC
AAATTTGTGGCAACTACACTTCAAAATCCCACTCACAAAAGTTTATCCAA
GTTCACAGCCAAGGACCTTTTTGGTGTCTATCCCAGTGAGAATGGGTACA
TAAATTTGTTTCAACAACTAGCAAAAGTTGAATTTAATAGAGTTCAGTCC
CTGCATAGAATGGAAATTGATAAAGTCACCAGATGGTGGCGAGACATTGG
TTTAGCTAAGGAATTAACTTTCGCAAGAGATCAACCGGTGAAGTGGTATA
TTTGGTCCATGGCCTGCCTAACCGATCCAATCTTGTCGAAACAAAGGGTT
GCGCTTACAAAATCCATTTCGTTTATCTATGTAATAGATGATATTTTCGA
CATGTACAGTTCACTTGATGAACTCATTCTCTTCACCCAGGCTGTCTCTA
GCTGGGAATATAGTGCTATACAAAAACTTCCAGACTCCATGAAGACATGC
TTTAGAGCCCTAGATAATATGATCAATGAGTCTAGCCATACGATCTATCA
AAAGCGTGGATGGAGCCCTTTACACTCTCTTCGGAAGACGTGGGCAAGTT
TGTGCGAAGCCTTTTTAGTAGAGGCAAAATGGTTTGCATCAAGGCACGTA
CCAAAGGCAAAAGAATACTTGGAAAATGGTGTGGTCAGCTCAGGAGTGCA
CGTAGTTCTGGTTCATATATTTGTTCTCTTGGATGAAACCAGTCTCACCC
AAAAGACACTGGATTTTGTGGAAAACATGCCTTCCATCATTACTTCTACA
GCATCGATTCTTAGGCTTTGGGATGACTTTGGTAGTGCCAAGGATGAGAA
TCAAGAAGGACATGACGGATCTTATGTGGAGTGTTACATGAAGGAATTAG
GAGGCAGTGTTGAAGATGCACGTGAGGAAATGATGGAAAAGATTTCAGAT
GCATGGAAGTGCCTCAACAAAGAATGCATACTTCGAAATCCAGCGTTTCC
ACCACCATTCCTCAAAGCTTCTCTCAATCTCGCAAGATTAGTTCCTTTGA
TGTATAATTATGATCACAACCAACGCCTACCCCACTTGGAAGAACATATC
AAATCTTTGTTATAG
Sequence Length
1665
Sequence Checksum
a944b5d8d0450e8629da6531009243a0
Summary
Resource Type
mRNA
Accession
MK801764.1
Organism
Name
MK801764.1
Identifier
MK801764.1
Time Accessioned
Friday, October 21, 2022 - 00:43
Time Last Modified
Friday, October 21, 2022 - 00:43