MK801762.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 21..44
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 45..54
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..20
NoneNo IPR availableTMHMMTMhelixcoord: 21..43
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..39
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..41
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 30..42
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..29
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availableCOILSCoilCoilcoord: 349..369
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 5..549
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 5..549
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 35..52
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 53..69
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..34
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 65..222
e-value: 8.6E-191
score: 636.7
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 228..493
e-value: 1.3E-104
score: 349.3
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..533
e-value: 8.6E-191
score: 636.7
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 223..551
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 46..195
e-value: 3.3E-52
score: 177.0
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 25..223

  • Cannabis sativa isolate CsTPS20CT hedycaryol synthase mRNA
  • complete cds
Sequences
Sequence
ATGTCAAATATTCAAGTCTTAGCTTCATCTCAATTAAGTGACAAAATTAT
TGCTCGTCCAACAACAAAATTTCACCCTTCTATTTGGGGTGATCGATTCC
TCCATTACAATATTTCAGAACAAGACTTGGTTTGCAAACAAGAAAAAGTT
GAAGAATTAATACAAGTTGTAAAGAAAGAGATATTATCTTCAAATCATGA
TCAATTGAAGTTGATTGACAATCTCCAACGTTTGGGATTATCATATCATT
TTGAGAGTGAAATTGAGAAATTGTTGGAACAATTAAGTATCACTCATCAT
CAAAATCATCATGATCTACATGATGCTTCTCTTTGGTTTAGATTATTAAG
ACAACATGGATTTAATGTTTCATCAAGTATATTTGAAAAATTCAAAGACG
AGGAAGGTAACTTTAAAGAAAGCCTAATAACCGATGTTCCAGGTTTGCTT
AGCTTGTATGAGGCTTCGCACTTGAGTTATGTTGGAGAAAGCATACTAGA
TGAAGCACTTGCTTTCACAACCACTCACCTTAAGGCTATTGTGGCAAATA
GTAAAGATCATCCATTATCACATCAAATATCCATAGTCCTGCATAGGCCT
CTAAGAAAGACCATAGAGAGGCTTCATGCTAGGTTTTACATCTCAATCTA
TGAAAAGGATGCCTCTCATAACAAACTATTGCTAGAGCTTGCAAAGTTAG
ACTTCAATCTACTTCAATGTTTCCACAAAAAGGAACTTAGTGAAATTACG
AGGTGGTGGAAGGAGCATGAGTTTGCAAAGAAATTCCCTTTTGCAAGAGA
TAGGATGGTGGAACTGTATTTTTGGATATTGGGTGTATATTATGAACCCA
AATACTCTCGAGCAAGGAAGCTTTTAACCAAAGTCATTGCATTGACCTCA
ATCACTGATGATATTTATGATGCATATGGTACTATTGATGAGCTTCAGCT
TCTTACCAAAGCAATTCAAAGGTGGGACATAAATTGTATGGATAAACTTA
AGCAAGAATATTTAAAGACATATTATAAGGTAATGTTGGATTCTTATGAA
GAATTTGAAAAGGAGCTTAAAAAGGAAGAATTATACAAACTTGAGTATGC
AAAAGAAGAGATGAAAAGAATTATTGGAGGTTATTTTGAAGAAGCTCGAT
GGTTGAATGAAGGATATTTCCCAAGCTTCGATGAGCATTTGAGAGTCTCT
TATGTTTCTTCTGGTAACGTTTTGTTGATAGCCACAAGTTTTGTAGGGAT
GCATGATGTTGTAACACATGAAACTCTAGATTGGCTCTCGAAAGACCCTA
AAATTGTTTCAGCTTCTACTCTCCTTTCTAGGTTCATGGATGATATTGGT
TCTCGCAAGTTTGAGCAAAAGAGAAATCACATACCATCTACAGTGGATTG
TTACATGAAACAATATGGGGTATCAGAGGAAGAGGCAATTAAAGAACTTA
ATAAAAGAGTGGACACCCACTGGAAAGAAATTAATGAAGACTTTATTAGG
CCAGCAGTTGTGCCCTTTCCTATCTTAGTTCGTGTTCTTAATTTTACAAA
AATAGTAGATCTTCTTTACAAAGAGGGCGATGATCAATACACAAATGTTG
GAAAAGTGCTCAAAGAAAGCATTGCTGCTTTGCTTATAGATTCAATCCCA
TTATAA
Sequence Length
1656
Sequence Checksum
5ef59fddf5ea6cc76254dfea31f94b0b
Summary
Resource Type
mRNA
Accession
MK801762.1
Organism
Name
MK801762.1
Identifier
MK801762.1
Time Accessioned
Thursday, October 20, 2022 - 12:32
Time Last Modified
Thursday, October 20, 2022 - 12:32