MK131289.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 7..27
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 28..73
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..6
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availableCOILSCoilCoilcoord: 37..57
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 4..569
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 4..569
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 18..21
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 22..66
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..21
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..9
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 10..17
NoneNo IPR availableTMHMMTMhelixcoord: 13..35
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 30..53
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..29
NoneNo IPR availableTMHMMTMhelixcoord: 12..34
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 249..514
e-value: 1.3E-107
score: 359.1
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..218
e-value: 3.0E-52
score: 177.1
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 29..553
e-value: 1.2E-192
score: 642.8
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 244..569
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 66..243
e-value: 1.2E-192
score: 642.8
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 26..244

  • Cannabis sativa isolate CsTPS16CC germacrene B synthase mRNA
  • complete cds
Sequences
Sequence
ATGTCTAGTCAAGTGTTAGCTTCATCTCAAAAAAATGACAAAACACAAAA
CATCATTCGACCAACAACAAAATTTCACCCACCAATTTGGGGAGATCGAT
TCCTCCATTACAATATTTCAGAACAAGAGTTGGAATATAAAGAGGGACAA
GTTGAAGAATTGAAAGAAGTTGTTAGGAAAGAGATATTCCATGGAAATAA
TAAAAGAAATATTATTAATGTTTCGAAACAATTAAAGTTAATTGATGATG
TGGAACGTTTGGGATTATCTTATCATTTTGAAAGTGAAATAGAAAAAAAG
CTACAACACATTTATGAAATTACTACCAATAATATTGATCATCAAGATCA
ACACTACTACTACTCCAACCATGATGAAGATCTACATGATGTCTCTATTC
GATTTAGATTACTACGACAACATGGATTTAACATTTCATCTAATATATTT
GAGAAATTCAAAGATGAGAGTGGTAAGTTTAAGGAAAGCTTGAAAAGTGA
CATTGAAGGTATGCTTAGCTTGTATGAAGCTTCATACTTGAGCTATGTTG
AAGAAAATATACTAGATGAGGCTCTTGCTTTCACTACCACCAATCTTAAG
TTAGTGGCCAACAAAAAAGAACATCCATTATCACATGAAATATCCTTAGC
CTTATATAGGCCTTTGAGAAAAACCCTAGTGAGGCTTTATGCTAGGCATT
ACATTTCAATCTATGAGAAACAACCTTCTCATAACAAAGTATTGCTACAA
TTTGCAAAGTTGGACTTCAATCTACTACAATCTTTGCATAAGAAGGAGCT
TAGTGAAATTTCCAGGTGGTGGAAAGAATTAGACTTGGCAAACAAACTAC
CATTTGCAAGAAATAGGATTGTGGAGCTATACCTTTGGATACTAGGAGTC
TTTCATGAACCTCAATTCTCTCTTGCAAGAAAAATCTTAATTAAAGCCAT
TTCAATGGCCTCAGTTGCAGATGATATTTATGATGCATATGGTACATTTG
AAGAACTTGAGCTCCTCACCGAAGCAATTCTCAGGTGGGACATAAGTTTT
ATAGATAAACTTAGTCCAGATTATTTGAAGACATATTATAAGGTATTTTT
GAATTCTTATGAAGAATGTGAAAAAGATCTTAAAAAGGAAGAGAGATACA
AACTTCACTATGCAAAAGAATCGATGAAAAAATTAATACAAGCTTATTTC
CATGAAGCACAATGGTTGAACCAAGGACATTTCCCAAGCTTTGATGAGCA
TTTGAAAGTTTCTTTTGTGTCTTCTGGTTACCCAATGTTGATTGAGACCT
CTTTTGTTGGAATGCAAGATGTTAAAACAAATCAAGTATTTGAATGGCTC
TCTACACAACCAAAGATTTTTAGAGCTTGCACTATCATTTCTAGATTCAT
GGATGACCTAGTTTCTCGTAAGTTCGAGCAAGAGAGGAATCACGTACCAT
CTACAGTAGATTGCTACATGAAGCAATATGGTGTATCGGAACAAGAGGCA
TGTGATGAGCTCAATAAACAAGTGGTTAATCTATGGAAAGAAATAAACCA
AGAGTTTCTTAGGCCAACTTCTATGCCTTCATCTATCTTAGTTAGAATTC
TTAATTTCACAAAAGTGCTTGACATTATCTACAAAGAAGGTGATGGCTAT
ACACATGTTGGAAAATTGGTTAAGGACAGTGTTGCTGCGTTGCTTATAGA
TCCCATCCCATTATAG
Sequence Length
1716
Sequence Checksum
a8f5449ba7073f0923d949d09bf8cb42
Summary
Resource Type
mRNA
Accession
MK131289.1
Organism
Name
MK131289.1
Identifier
MK131289.1
Time Accessioned
Friday, October 21, 2022 - 20:02
Time Last Modified
Friday, October 21, 2022 - 20:02