KY014558.2

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableTMHMMTMhelixcoord: 10..32
NoneNo IPR availableCOILSCoilCoilcoord: 74..94
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 42..593
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 42..593
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 46..56
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 25..45
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..24
NoneNo IPR availableTMHMMTMhelixcoord: 26..45
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..40
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 17..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..16
NoneNo IPR availableTMHMMTMhelixcoord: 17..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 28..40
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..27
NoneNo IPR availableTMHMMTMhelixcoord: 4..26
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 89..261
e-value: 2.7E-183
score: 611.9
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 267..540
e-value: 4.4E-98
score: 327.9
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 53..212
e-value: 1.3E-42
score: 145.7
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 52..578
e-value: 2.7E-183
score: 611.9
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 262..592
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 50..262

  • Cannabis sativa isolate Purple_Kush_TPS13 terpene synthase mRNA
  • complete cds
Sequences
Sequence
ATGCTTTATAGACCAAAAATATATACTAACTATAATATTATTAATGGTGG
TACAAAATCAAGATTATCAAGTGCATGCTACCCCATCCAATGTGCTGTGG
TCAATAGTTCTAATGCAATTATTGATCGACGATCAGCCAACTTTGAGCCC
TCCATTTGGTCTTTCGATTATATTCAATCTCTTACAAGTCAATATAAGGG
AGAACCTTATACAAGTCGAGTGAAAAAACTTGAGAGAGATGTGAAAAAAA
TATTAGTTGAGATGGAAAACTCTTTAGCTCAACTTGAACTCATTGATACA
TTGCAAAGACTTGGAATATCTTACCGTTTTGAGAATGAAATAAATTCTAT
TTTGAACAAAAAATATCTCAATATTAATAATCCTAATTATTCCGATCTTT
TATATGCTATTGCTCTTGAATTTAGGCTTCTACGTCAACATGGCTATGCA
GTACCTCAAGAGATTTTTAATCAGTTGAAGAACGAGATAGAAAACATCAA
AAAAAACATAAATGGTAATGATATCATGGGAATATTAGCCTTATACGAAG
CTTCTTTTTATGAGAAAAAATGCGAAAGTATTTTAAAGGAAGCTAGAATT
TTCACAACTGAATGTCTCAAAAACTACACTATAATGATATCAGAGCAAAA
AAAGTTAATGATTGATAATGATTATGATTATGATATCGAAGTAGTGAATC
ATGCTTTAGAGCTCCCACTTCATCGGAGGACCACAAGAACAGAAGCAAAG
TGGTTCATTGACGCATATGCGAAAAAACAAGACATGAATCCTATGTTGCT
TGAGTTAGCCAAACTCGATTTCAACATAGTACAATCAACACATCATGAAG
ATCTAAAACATATATTCAGGTGGTGGAGACATACTAAACTTGGAGAGAAA
TTGAATTTTGCAAGAGATCGATTGATGGAATGTTTCTTATGGAAAGTTGG
AATAAGATTTGAGCCAAAATTCAGTTATTTTAGAATAACAACTGCCAAAT
TATTTGAGCTAATAACAGTAATTGATGATATATATGATGTTTATGGAACA
TTGGATGAATTAGAGCTTTTCACCAAAGCTGTTGAGAGATGGGATGTGAA
AATGATAAATGAGTTACCAGAATACATGAAGATGCCTTATCTTGTTTTAC
ACAATACCATAAATGATATGGTATTTGAGGTGTTAAGAGACCAAGAAATT
TCCATCAACATTCAATACCTTAAGAAAACGTGGGTAGATATGTGTAGAGG
TTTTTTACAAGAGGCAAAATGGTACTATAGTGGATATACACCAACACTAG
AAGAATATATTGAAAATGGTTGGATTTCAGTGGGAGCACCGGTTCTAATT
GTGCATGCTTATTTTTCTCATGCAAATTATAATCACACAGTTACAAGTAG
TAAAGAGATTTTTGAATGCTTTGAACATGGTTATTATCCTGCCATAATTC
GTCATAGTGCCATAATATTACGACTTACAAATGACCTAGCAACATCATCG
GAGGAATTGAAAAGAGGTGATGCTCCGACATCAATTCAATGTTACATGCA
AGAAAAAAATGTATCTGAAGAGGAAGCTCGTGAACATATTAAGTTTTTAA
TAAATGAAGCATGGAAGGAGATGAATAATGATGTTGGATTATATCCAATC
TCATTGACTGAAGATGCTACAAACTTTGCTAAGATGGGATTTTTCATATA
TCAACATGGTGATGGTCATAGTTCTCAAGATAATCAATCCAAACAAAAAA
TTTCATCCTTGATTATTGAACCTATTCCCTTATATACATAA
Sequence Length
1791
Sequence Checksum
f72196743bbe2ee841b1541a7ec15ae7
Summary
Resource Type
mRNA
Accession
KY014558.2
Organism
Name
KY014558.2
Identifier
KY014558.2
Time Accessioned
Friday, October 21, 2022 - 20:01
Time Last Modified
Friday, October 21, 2022 - 20:01