KY014565.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 45..56
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..24
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 25..44
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 16..560
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 16..560
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..15
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 16..35
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 36..44
NoneNo IPR availableTMHMMTMhelixcoord: 20..42
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..21
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..50
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 22..39
NoneNo IPR availableTMHMMTMhelixcoord: 20..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..26
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 27..47
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 48..71
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 33..47
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..13
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 26..32
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 14..25
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..32
NoneNo IPR availableTMHMMTMhelixcoord: 13..35
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..28
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 29..70
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 6..14
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..5
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 19..48
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..18
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 15..18
NoneNo IPR availableTMHMMTMhelixcoord: 13..32
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 26..206
e-value: 2.8E-52
score: 177.2
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 27..246
e-value: 2.5E-73
score: 248.2
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 237..504
e-value: 3.7E-93
score: 311.7
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 247..560
e-value: 6.4E-116
score: 388.6
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 233..561
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 24..231

  • Cannabis sativa isolate Finola_TPS2 terpene synthase mRNA
  • complete cds
Sequences
Sequence
ATGTGTAGTTTGGCCAAAAGCCCTAGTAGTGATACTAGTACAATTGTTAG
AAGATCAGCCAACTATGATCCTCCCATTTGGTCTTTTGATTTCATTCAGT
CTCTTCCATGCAAATATAAGGGAGAACCCTATACAAGTCGATCGAATAAG
CTAAAAGAAGAAGTGAAAAAGATGTTAGTTGGAATGGAAAACTCTTTAGT
CCAACTTGAGTTGATTGATACATTACAAAGACTTGGAATATCTTATCATT
TTGAGAATGAAATCATTTCTATTTTGAAGAAATATTTCACTAATATTAGT
ACTAATAAAAACCCTAAATATGATTTATATGCCACTGCTCTCGAATTTAG
GCTTTTACGCGAATATGGATATGCAGTGCCTCAAGAAATTTTTAATGATT
TTAAGGACGAGACGGGAAAGTTCAAAGCGAGTATTAAAAATGATGATATT
AAGGGAGTATTGGCTTTATATGAAGCTTCATTCTATGTGAAAAATGGCGA
AAATATTTTGGAGGAAGCTAGGGTTTTCACAACAGAATATCTCAAAAGAT
ATGTAATGATGATTGATCAAAACATGATATTAAATGATAATATGGCAATA
TTAGTGAGACATGCCTTGGAGATGCCACTTCATTGGAGGACTATAAGAGC
AGAAGCTAAGTGGTTCATTGAAGAATATGAGAAAACACAAGACAAGAATG
GCACTTTGCTTGAATTTGCGAAATTGGATTTCAACATGCTTCAATCAATA
TTTCAAGAAGATCTAAAACATGTCTCGAGGTGGTGGGAACATTCTAAGCT
TGGAAAGAATAAAATGGTTTATGCTAGAGATAGATTGGTAGAGGCTTTTC
TATGGCAGGTTGGAATAAGATTTGAGCCACAATTCAGCCACTTTAGGAGA
ATATCTGCAAGAATATATGCTCTAATTACAATCATAGATGACATATATGA
TGTGTATGGAACATTGGAAGAATTAGAGCTTTTCACCAAGGCTGTTGAGA
GATGGGATGTGAAAACCGTAGACGAGTTACCAGATTATATGAAGCTGCCT
TTCTTTACTTTATTTAACACCGTAAATGAAATGGCGTATGATGTGTTAGA
AGAGCATAATTTTGTCAGCGTTGAATACCTCAAGAACTCGTGGGCAGAGT
TATGTAGATGCTATTTGGAAGAGGCAAAATGGTTTTATAGCGGATACAAA
CCAACCTTGAAGAAATATATTGAGAACGCCTCGCTTTCAATAGGAGGACA
AGTTATTTTTGTGTATGCTTTTTTCTCTCTTACAAAGTCCATAACAAATG
AGGCCTTAGAGTCCTTGCAAGAGGGTCATTACGCTGCATGTCGCCAAGGA
TCCTTGATGTTACGACTTGCAGATGATCTTGGAACATCATCAGATGAATT
GAAAAGAGGTGACATTCTTAAATCGGTTCAATGTTACATGCACGAGACTG
GTGTTTCTGAAGATGAAGCTCGTGAGCACATCAAATTTTTGATAAGTGAA
ATATGGAAGGAGATGAATGATGAAGATGAATATAACTCTATTTTCTCTAA
AGAGTTTGTTCAAGCTTGCAAAAATCTTGGTAGGATGTCATTATTTATGT
ATCAACATGGAGATGGACATGCTTCTCAAGATAGCCATTCAAGGAAACGT
ATTTCAGATTTAATTATTAACCCTATTCCTTTATAA
Sequence Length
1686
Sequence Checksum
2e4ac6b37143502f908645787058ad08
Summary
Resource Type
mRNA
Accession
KY014565.1
Organism
Name
KY014565.1
Identifier
KY014565.1
Time Accessioned
Thursday, October 20, 2022 - 06:21
Time Last Modified
Thursday, October 20, 2022 - 06:21