KY014564.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..43
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 44..56
NoneNo IPR availableTMHMMTMhelixcoord: 21..43
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 18..56
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..17
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..2
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 3..12
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 13..17
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 11..21
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..10
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 22..25
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..25
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 26..85
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 7..555
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 7..555
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..539
e-value: 1.2E-190
score: 636.2
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 230..554
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 66..229
e-value: 1.2E-190
score: 636.2
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 235..500
e-value: 3.2E-106
score: 354.5
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 28..204
e-value: 1.5E-52
score: 178.1
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 25..227

  • Cannabis sativa isolate Finola_TPS4 terpene synthase mRNA
  • complete cds
Sequences
Sequence
ATGTCATATCAAGTTTTAGCCTCATCACAAAATGACAAAGTATCAAAAAT
TGTTCGTCCAACAACAACTTATCAACCTTCTATTTGGGGGGAGAGATTTC
TCCAATATAGTATTTCAGACCAAGACTTTAGCTATAAAAAGCAGCGAGTT
GACGAATTAAAGGAAGTGGTAAGGAGAGAGGTATTTTTAGAATGTTATGA
TAATGTTTCATATGTGTTGAAGATAGTGGATGATGTTCAACGTTTGGGAT
TGTCGTATCATTTTGAAAATGAAATAGAAAAAGCGCTACAACACATTTAC
GATAACACTATTCATCAAAACCACAAAGATGAAGATTTACATGACACTTC
TACCCGCTTTAGACTATTGCGCCAACATGGATTTATGGTTTCATCTAATA
TATTTAAAATATTTAAAGATGAGCAAGGGAATTTTAAGGAGTGCTTGATA
ACTGACATTCTTGGTTTGCTGAGCTTATATGAGGCCTCACATTTAAGCTA
TATTGGCGAGAATATATTAAATGAAGCACTTGCTTTCACCACCACTCACC
TTCATCAGTTTGTGAAAAATGAAAAAACACATCCATTATCAAATGAAGTA
TTACTAGCCTTGCAGAGACCTATAAGAAAGAGCCTAGAGAGGCTCCACGC
CAGGCATTACATTTCATCTTACGAAAACAAGATTTCTCATAACAAAACAT
TGCTAGAACTTGCAAAGTTGGATTTCAATCTATTACAATGTTTGCATAGA
AAAGAGCTTAGTCAAATTTCCAGGTGGTGGAAAGAAATAGACTTTGTACA
CAAACTACCTTTTGCAAGAGATAGGATTGTGGAGCTATACCTTTGGCTAT
TAGGAGTTTTTCATGAACCTGAATTGTCACTGGCAAGAATTATTTCAACA
AAAGTTATTGCATTGGCCTCAGTTGCAGATGATATTTATGATGCATATGG
TACATTTGAAGAGCTTGAGCTCCTTACTGAATCAATTAATAGGTGGGACT
TAAATTGTGCGGATCAACTTCGTCCAGAATGTTTACAGACATTTTATAAG
GTTCTTTTAAATTGTTATGAAGAATTTGAGAGTGAGCTTGGAAAGGAGGA
AAGTTACAAAGTTTACTACGCAAGAGAAGCGATGAAAAGATTACTTGGAG
CATATTTCAGTGAAGCTCGATGGTTGCACGAAGGATATTTCCCTAGCTTC
GATGAGCATTTGAAGGTTTCTTTGATTTCTTGTGGATACACCATGATGAT
AGTGACCTCTTTAATTGGCATGAAAGATTGTGTAACAAAGCAAGATTTTG
AGTGGCTCTCAAAAGACCCCAAGATAATGAGAGATTGCAATATCCTTTGT
AGGTTCATGGATGACATAGTCTCTCATAAGTTTGAGCAACAAAGAGATCA
TTCACCGTCTACCGTTGAGAGTTACATGAGGCAATATGGGGTGTCAGAAC
AAGAGGCATGTGATGAGCTAAGAAAGCAAGTGATTAATTCATGGAAAGAA
ATAAACAAAGCATTCCTCAGGCCTTCTAATGTGCCTTATCCAGTTTTATC
TCTTGTTCTCAATTTTTCGAGAGTAATGGATCTTCTCTACAAAGATGGTG
ATGGCTATACGCATATTGGAAAAGAGACAAAAAATAGTGTTGTTGCGTTA
CTTATAGATCAAATCCCATGA
Sequence Length
1671
Sequence Checksum
9cf22203f1dc0ec29b8a21f9dc1b9dd5
Summary
Resource Type
mRNA
Accession
KY014564.1
Organism
Name
KY014564.1
Identifier
KY014564.1
Time Accessioned
Friday, October 21, 2022 - 20:01
Time Last Modified
Friday, October 21, 2022 - 20:01