KY014563.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 14..18
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..18
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 4..13
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 19..43
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..3
NoneNo IPR availableTMHMMTMhelixcoord: 4..23
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 34..46
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..33
NoneNo IPR availableTMHMMTMhelixcoord: 11..33
NoneNo IPR availableCOILSCoilCoilcoord: 74..94
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 42..591
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 42..591
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 34..40
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..33
NoneNo IPR availableTMHMMTMhelixcoord: 10..32
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..40
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 17..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..16
NoneNo IPR availableTMHMMTMhelixcoord: 17..39
NoneNo IPR availableSIGNALP_EUKSignalP-noTMSignalP-noTMcoord: 1..23
score: 0.472
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 53..274
e-value: 7.6E-64
score: 217.1
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 275..592
e-value: 6.1E-115
score: 385.5
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 260..590
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 265..538
e-value: 3.9E-95
score: 318.2
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 53..210
e-value: 3.6E-43
score: 147.5
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 50..260

  • Cannabis sativa isolate Finola_CsTPS6 terpene synthase mRNA
  • complete cds
Sequences
Sequence
ATGCTTTATAGACCAAAAATATATACTAACTATAATATTATTAATGGTGG
TACAAAATCAAGATTATCAAGTGCATGCTACCCCATCCAATGTGCTGTGG
TCAATAGTTCTAATGCAATTATTGATCGACGATCAGCCAACTTTGAGCCC
TCCATTTGGTCTTTCGATTATATTCAATCTCTTACAAGTCAATATAAGGG
AGAACCTTATACAAGTCGAGTGAAAAAACTTGAGAGAGATGTGAAAAAAA
TATTAGTTGAGATGGAAAACTCTTTAGCTCAACTTGAACTCATTGATACA
TTGCAAAGACTTGGAATATCTTACCGTTTTGAGAATGAAATAAATTCTAT
TTTGAACAAAAAATATGTCAATATTAATAATCCTAATTATAATTTATATG
CTATTGCTCTTGAATTTAGGCTTCTACGTCAACATGGCTATGCAGTACCT
CAAGAGATTTTTAATCAGTTGAAGAACGAGATAGAAAACATCAAAAAAAA
CATAAATGGTAATGATATCATGGGAATATTAGCCTTATACGAAGCTTCTT
TTTATGAGAAAAAATGCGAAAGTATTTTAAAGGAAGCTAGAATTTTCACA
ACTGAATGTCTCAAAAACTACACTATAATGATATCAGAGCAAAAAAAGTT
AATGATTGATAATGATTATGATTATGATATCGAAGTAGTGAATCATGCTT
TAGAGCTCCCACTTCATCGGAGGACCACAAGAACAGAAGCAAAGTGGTTC
ATTGACGCATATGCGAAAAAACAAGACATGAATCCTATGTTGCTTGAGTT
AGCCAAACTCGATTTCAACATAGTACAATCAACACATCATGAAGATCTAA
AACATATATTCAGGTGGTGGAGACATACTAAACTTGGAGAGAAATTGAAT
TTTGCAAGAGATCGATTGATGGAATGTTTCTTATGGAATATTGGAATAAG
ATTTGAGTCAAAATTCAGCTATTTTAGAACAAAAACTGCCAAATTATTTG
AGCTAGTAACATTTATAGATGATATATATGATGTTTATGGAACATTGGAT
GAATTAGAGCTTTTCACCAAAGCTGTTGAGAGATGGGATGTGAAAATGAT
AAATGAGTTACCAGAATACATGAAGATGCCTTATCTTGTTTTACACAATA
CCATAAATGACATGGTTTTTGAGGTGTTAAGAGACCAAGAAATCTCCATC
AACATTCAATACCTTAAGAAAACGTGGGTCGATATGTGTAAAAGTTTCTT
GCAAGAGGCAAAATGGTACTATAGTGGATACACACCAACATTGGAAGAAT
ATATTGAAAATGGTTGGATTTCAGTAGGAGCACCAGTTATTCTTGTGCAT
GCTTATTTTTTTCACGCAAATAATAATCGCACAATTACAAATACTAAAGA
GATTTTCGAATGCTTGGAATATGGTTATTATCCTGCCATTATTCGTCACA
GTGCCATAATATTACGATTTACAAATGACCTAGCAACATCATCGGAGGAA
TTGAAAAGAGGTGATGCTCCGACATCAATTCAATGTTACATGCAAGAAAA
AATTGTATCTGAAGAGGAAGCTCGTGAACATATTAAGTTTTTAATAAATG
AAGCATGGAAGGAGATGAATAATGATGTTGGATTATATCCAATCTCATTG
ACTGAAGATGCTACAAACTTTGCTAAGATGGGATTTTTCATATATCAACA
TGGTGATGGTCATAGTTCTCAAGATAATCAATCCAAACAAAAAATTTCAT
CCTTGATTATTGAACCTATTCCCTTATATACATAA
Sequence Length
1785
Sequence Checksum
451d3bea2ed57b58a5bad41b6efa99a0
Summary
Resource Type
mRNA
Accession
KY014563.1
Organism
Name
KY014563.1
Identifier
KY014563.1
Time Accessioned
Friday, October 21, 2022 - 18:06
Time Last Modified
Friday, October 21, 2022 - 18:06