KY014561.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..14
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 15..36
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 37..42
NoneNo IPR availableTMHMMTMhelixcoord: 15..37
NoneNo IPR availableCOILSCoilCoilcoord: 91..111
NoneNo IPR availableCOILSCoilCoilcoord: 236..256
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 66..626
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 66..626
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 473..491
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..472
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 492..629
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 33..57
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..32
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..31
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 32..50
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 57..87
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 5..16
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 22..36
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..21
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 37..56
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 17..21
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..4
NoneNo IPR availableTMHMMTMhelixcoord: 37..56
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..29
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 30..42
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..21
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 22..41
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 42..54
NoneNo IPR availableTMHMMTMhelixcoord: 20..39
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..28
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 29..49
NoneNo IPR availableTMHMMTMhelixcoord: 6..28
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 76..610
e-value: 5.5E-198
score: 660.4
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 297..625
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 77..245
e-value: 2.2E-49
score: 167.8
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 113..296
e-value: 5.5E-198
score: 660.4
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 303..570
e-value: 7.7E-94
score: 314.0
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 74..296

  • Cannabis sativa isolate Finola_TPS3 terpene synthase mRNA
  • complete cds
Sequences
Sequence
ATGGCTGTTCACCAATTTTCTCCATCAATAGTATCATCACTACCTACCAT
TAGTACTTATAATAATAATCACTTTTGTAGATTTTTCACACCAAAAACAT
CTATTAGTCCTATTTCAAAAACAAAATCAAAATCAAGCACTTGCTATCCC
ATCCAATGTACTGTGGTCAATAATAGTAGCCCTAGTTCTACTATTGTTCG
AAGATCGGCCAATTATGAACCTCCGATTTGGTCTTTCGATTACATTCAAT
CTCTTTCAACCCAATATAAGGGAGAATCCTATACAAGGCAATTAAATAAG
TTAAAGAAAGAAGTGAAAAGGATGCTCCTTCGAATGGAGATTAACTCTTT
AGCCCTACTCGAGCTAATCGATACATTGCAAAGGCTTGGAATATCTTACC
ATTTTAAGAATGAAATAAACACTATTTTGAAGAAAAAATACAATGATAAT
TATATTAACAATAATATTATTACTAACCCTAATTATAATAATTTATATGC
CACTGCTCTCGAATTTAGGCTTCTACGCCAACATGGCTATACAGTACCTC
AAGAAATTTTTAATGCTTTCAAGGATAAGAGAGGGAAATTTAAAACATCC
TTGAGTGATGATATTATGGGAGTATTGTGTTTATATGAAGCTTCATTCTA
TGCTATGAAACATGAAAATATTTTGGAGGAAGCAAGAATTTTTTCAACTA
AATGTCTTAAAAAATACATGGAGAAAATAGAGAATGAGGAAGAGAAAAAA
ATATTATTATTAAATGATAATAATATTAATAGTAATTTGCTATTAATTAA
TCACGCTTTCGAGCTTCCGCTTCATTGGAGAATAACAAGATCGGAAGCTA
GGTGGTTCATTGACGAAATATATGAGAAAAAACAAGACATGAATTCGACT
TTGTTCGAGTTTGCGAAATTAGATTTTAATATAGTGCAATCAACACACCA
AGAAGATTTACAACATTTATCGAGGTGGTGGAGGGATTGTAAACTTGGTG
GGAAATTGAATTTTGCTAGAGATAGATTGATGGAGGCTTTCTTATGGGAT
GTTGGACTAAAATTCGAGGGAGAATTCAGCTATTTTAGAAGAACAAATGC
AAGATTATTTGTGCTTATAACAATAATTGATGATATTTATGATGTATATG
GAACTTTGGAGGAATTAGAGCTTTTCACTAGCGCTGTTGAAAGATGGGAT
GTGAAATTAATCAATGAGTTACCAGATTACATGAAGATGCCTTTCTTTGT
TTTACACAATACCATAAATGAGATGGGGTTCGATGTATTAGTAGAACAAA
ACTTTGTCAACATTGAATACCTTAAGAAATCGTGGGTAGATTTATGTAAA
TGTTATTTACAAGAAGCAAAATGGTATTATAGTGGATACCAACCAACATT
GGAAGAATACACTGAGTTGGGTTGGCTTTCAATAGGAGCATCAGTAATTC
TTATGCATGCTTATTTTTGTTTCACAAATCCTATAACAAAACAAGACTTG
AAAAGCTTGCAATTACAACATCATTATCCCAACATAATTAAACAAGCATG
CTTGATTACAAGGCTTGCAGATGATTTAGGAACATCTTCGGATGAATTGA
ATAGAGGCGACGTTCCTAAATCGATTCAATGTTACATGTACGATAATAAT
GCTACCGAAGACGAAGCTCGTGAACACATCAAGTTCTTGATAAGTGAAAC
ATGGAAGGATATGAATAAGAAAGATGAAGATGAGAGTTGTTTATCAGAAA
ATTTTGTTGAAGTTTGCAAAAATATGGCTAGAACAGCACTATTCATATAT
GAGAATGGAGATGGACATGGTTCTCAGAATAGTTTATCAAAAGAACGTAT
TTCAACCTTGATTATTACTCCAATTAATATTCCTAAATAA
Sequence Length
1890
Sequence Checksum
5e46e35b89807d48dc7a6fef00074ffb
Summary
Resource Type
mRNA
Accession
KY014561.1
Organism
Name
KY014561.1
Identifier
KY014561.1
Time Accessioned
Friday, October 21, 2022 - 20:00
Time Last Modified
Friday, October 21, 2022 - 20:00