KY014560.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 30..214
e-value: 2.8E-49
score: 167.4
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 248..514
e-value: 5.4E-98
score: 327.6
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 66..242
e-value: 1.7E-197
score: 658.8
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 29..552
e-value: 1.7E-197
score: 658.8
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 244..573
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 19..572
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 19..572
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 27..237

  • Cannabis sativa isolate Finola_TPS5 terpene synthase mRNA
  • complete cds
Sequences
Sequence
ATGTCACTATCAGGACTAATCTCCACTACTACTTTCAAAGAACAACCAGC
AATAGTCCGTCGATCAGGAAACTACAAACCCCCATTGTGGGATGCTCATT
TTATCCAATCACTCCAAGTCATATATACGGAGGAAAGCTATGGGAAAAGA
ATCAATGAGCTGAAAGAAGATGTGAGAAGAATTCTTGAGAAGGAGGCTGA
AAATCCTTTAGTTAAGCTTGAACAGATTAATGATTTGAGCAGACTTGGAA
TATCTTATCACTTTGAAGATCAAATTAAGGCAATATTAAACCTTACATAT
AATAATAATAATGCATTGTGGAAGAAAGATAATCTGTATGCCACTGCTCT
TCATTTCAAACTCCTTAGACAATATGGATTCAATCCTGTATCTTCAGAGA
TTTTCAATGCTTTCAAAGACGAGAAAAAGGAGTTCAAGGAGAGTTTGAGT
AAAGATGTGAAAGGAATGGTATGTCTATATGAGGCTTCATTCTATTCATT
TAGGGGTGAACCCATATTAGATGAAGCAAGAGATTTCACAACCAAACATC
TCAAACAATACTTGATGATGACGAGGCAAGGTCAAAATGTTGACCATGAT
GATGATAATGATTTAATGGTGAAATTAGTGGAGCATGCTTTGGAGCTTCC
AGTGCATTGGAGAATGAAAAGGTTGGAGGCAAGGTGGTTTATTGATATGT
ATGCTGAAATGTCTCATCATCATCATATGAATTCAACTTTTCTTCAACTT
GCTAAACTAGATTTTAACGTTGTACAATCAACATACCAAGAAGACCTTAA
ACATGTTGTAAGGTGGTGGAAAACTACTAGTCTAGGAGAGAGGTTACCCT
TTGCAAGAGATAGGATAGTTGAAATTTTCTTATGGAGTGTGGGACTTAAA
TTTGAGCCACAGTTTAGATATTGCCGAAAAATGCTCACAAAGATTGGTCA
ATTGGTAACGACAATGGACGATATATTTGACGTGTATGGTACGCTTGATG
AGCTAAGCCTCTTTCAACACGCATTGGGAAGGTGGGATATAAATACGATC
GACCAACTTCCAGATTACATGAAGATATTTTTTTTGGCTACTTATAATGT
GGTGAATGAAATGGCGTATGACGTGCTAAAACAAAATGGCATTCTCATTA
TCAAATATTTAAAGAAAACGTGGACGGATTTATGTAAATGTTACATGTTG
GAGGCAAATTGGTATCATAGTGGATACACACCAAGCTTGGAAGAATACAT
TAAAAATGGATGGATATCAATTGCAGAACCCTTAATTCTAGTCAATCTTT
ATTGCCTTATAACCAATCCAATAAAAGAAGATGACATAGACTGCTTGCTT
CAATATCCCACCTTTATTCGTATCTCAGGAATCATTGCTCGACTTGTTGA
TGATTTAGGAACTTCATCGGATGAACTGAAAAGAGGAGACAATCCTAAAT
CGATTCAATGCTATATGAAAGAAAATGGTATTTGTGATGAAAAGAATGGC
CGTGAACACATAAGGAATTTAATCAGTGAAACATGGAAGGAAATGAATGA
AGCTCGAGTGGGTGAGTCTCCATTTTCTCAAGCTTTTATTGAAACTGCCA
TAGATTTCGTTAGGACAGCAATGATGATATACCAAAAGGAGCAAGATGGG
GTTGGTACTAATTTTGATCATTACACAAAAGATGGAATCATTTCCTTGTT
CTTCACTTCCATTCCCATTTGA
Sequence Length
1722
Sequence Checksum
878a5e661adc7721d903831a5fc1bb90
Summary
Resource Type
mRNA
Accession
KY014560.1
Organism
Name
KY014560.1
Identifier
KY014560.1
Time Accessioned
Friday, October 21, 2022 - 20:00
Time Last Modified
Friday, October 21, 2022 - 20:00