KY014559.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 36..67
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..14
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 15..35
NoneNo IPR availableTMHMMTMhelixcoord: 13..35
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..35
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 53..53
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 36..52
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 13..36
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 37..52
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..12
NoneNo IPR availableTMHMMTMhelixcoord: 13..35
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..30
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 31..56
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 44..612
NoneNo IPR availablePANTHERPTHR31225:SF74TRICYCLENE SYNTHASE, CHLOROPLASTICcoord: 44..612
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDESignal Peptidecoord: 1..23
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 24..613
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_H_REGIONSignal peptide H-regioncoord: 3..15
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_N_REGIONSignal peptide N-regioncoord: 1..2
NoneNo IPR availablePHOBIUSSIGNAL_PEPTIDE_C_REGIONSignal peptide C-regioncoord: 16..23
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..34
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 35..57
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 65..596
e-value: 2.3E-183
score: 612.2
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 284..609
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 289..555
e-value: 8.5E-94
score: 313.8
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 66..231
e-value: 1.5E-40
score: 139.0
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 104..283
e-value: 2.3E-183
score: 612.2
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 63..283

  • Cannabis sativa isolate Purple_Kush_TPS12 terpene synthase mRNA
  • complete cds
Sequences
Sequence
ATGCGCTTGGGAGTTCATCAATTTTCTCCACTTTCATTAATCCTTAATAC
TACAAAATTAGCAAGAGCAAGTACATTATCAAGTGCTTGCTACCCCATCC
AATGTACTATGGTCAATAGTACAAATATTACTAATAATACTACTATATTT
GATAATCATATTCATAGAAGATCAGCCAATTATGAACCTCCCATTTGGTC
TTTTGATTACATTCAATCTCTTTCATCAAGCCAATATAAGGGAGAAACAT
GTACAAGTAGATTGAATGAGCTAGAGGCAAATGTGAAAGAGATATTGTTA
GTTGAGATGAAATCTAACTCTTTAGCTCAACTTGAGTTTATTGATGCATT
GCAAAGACTTGGATTATCTTACCGTTTCGAGACTGAAATAAACACTATTT
TAAATGAAAAGTACTCCGGTAATATTATCGATAACCCTAATTATAATTTG
TACGCCACAGCTCTCGAATTCAGGCTTCTACGCCATCATGGTTATGATGT
ATCTCAAGAAATTTTCAATGTGTTTAAGGATGAGATTACAAGCAAGTTCA
AGGCAAGAACGAGTGGCGAAGATATAATTGGAGTATTGGCTTTATACGAA
GCTTCATTCTATGGCAAAAAAAGTGAAAGTATTTTGGAAGAAGCTAGGGT
TTCCTCAATCGAATGTCTCGAAAATTACGTAGCAACTATGACGATGGAGC
GAAACAAACCATCATTATTAGTCAATGATTATGATGATGATAATAATATG
TTATTATTAGTGAATCATGCCTTGGAGCTTCCACTTTATTGGAGAATAAC
AAGATCAGAAGCAAGGTGGTTCATTGATTTATATGAAAAAAATCATAACA
TGAATTCTACTTTGCTTGAATTTGCCAAATTGGATTACAACATGGTACAA
TCCATATATCAAGAAGATCTAAAACATCTCTCAAGGTGGTGGAGCCATAC
AAAACTTGGAGAGAAAATGGATTTCTTTAGAGATAGATTAATGGAGTGTT
TCTTATGGACTGTGGGAATAGCATGTGAGCCAGAAAAAAGCTATTATAGA
AGAATGTCTGGAAGATTATATGTTCTAATAACAACAATTGATGATATATA
TGATGTTTATGGAACATTGGAGGAATTAGAGCTTTTCACTAATGCAGTTG
AGAGATGGGATGTGAAAGCAATGGATGATTTACCAGAATATATGAGGATG
CCTTTCTTTCTTTTACACAATACCATAAACGAAATGGCTTTCGATGTGTT
AGGACACCAAAATTTCCTCAACGTTAAATTCCTTAAGAGGACGTGGGTAG
ATTTCTGTAAACATCAATTACAAGAGGCAAAATGGTTTCACAGTGGATAC
AAACCAACATTCGAAGAATACATTAACAATGCATGGATTTCGGTATCAGG
ACCGATTATTCTTATGGATGCTTATTTCTCTCTTACAAATCCTGTTACAA
AAGATGCCATAAATTTACTGGAATTAGGTTATCCACCCATAATTTACCAT
GCATCCATGATTCTACGACTTACAGATGATCTAGGAACATCGAATGATGA
AATGAAAAGAGGTGATATTCCGAAATCAATTCAATGTTACATGAACGATA
CAGGTGTTTCTGAAGATGAAGCTCGAGATCATATGAAGTTTCTAATAAGT
GAATTATGGAAGGAAATAAATAATGAAGATGAAAATATGGACTCTCCTTT
CTCAAAACAATTTCTTCAAAATTGTAAAAATCTTGCTAGAATATCACAAT
TTATATATCAATATGGAGATGGACATGCTTCTCAGGATAGTTTATCAAAA
CAAAGAATTTCAGAATTGATAATTAATCATATTCCTTCTTAA
Sequence Length
1842
Sequence Checksum
8980ec32f0681bd29ad079267f1755c4
Summary
Resource Type
mRNA
Accession
KY014559.1
Organism
Name
KY014559.1
Identifier
KY014559.1
Time Accessioned
Friday, October 21, 2022 - 19:59
Time Last Modified
Friday, October 21, 2022 - 19:59