TPS63

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 186..447
e-value: 2.6E-83
score: 279.5
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 5..134
e-value: 5.9E-33
score: 114.2
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 1..193
e-value: 7.8E-42
score: 145.0
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 194..497
e-value: 2.4E-118
score: 396.6
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 183..488
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 5..497
NoneNo IPR availablePANTHERPTHR31225:SF99coord: 5..497
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 26..62
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..25
NoneNo IPR availableTMHMMTMhelixcoord: 7..29
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 4..169

TPS63
Sequences
Sequence
GAACGCTCCATAGAAGCTTTGAACTTGGTCAACGCTGTGCTTAGAGTCGG
CATTGATTATCATGTCCAAGATGAGATTAAATCTATCCTTGAAAGGGAAC
ATATAATTTTCAGTGACCATATTAGTAACCAATATTTTAATAATATTAAT
CAAGACCACCTGTATGAGGTTTCTCTTCGTTTCCGATTACTGAGACAAGG
AGGTTATGATGTCTCTCCAGATGTGTTTAACGAGTTGATGAAGGACAAAA
AGGGAAATTTCAATGTTTTAGTGGAAGAAGACAGAGAGGGACTAAGAGAA
TTGTTTGAAGCCTCACAAGTAAGAATAGAAGGAGAAGAGGTACTAGAGGA
AGCTGAAGTGTTCAGTGGCGAACACCTAAAAGAATGGGCAAATCTTCATC
GTCATACGAGTGAAGCTCGAAGTATTCAATTAACGTTAGACCAACCTTGT
CATAAAAGCTTGGCCAGGGTCACATCTCCAAACTTTTTGGACAGTTTCTC
AGCCAACACTGCTACCAGAGACCAAGGCTGGACCTGGATGACCCTTTTAA
ACAAACTGGTCACAATGGACTTCAAAATAGTTCAGTCTATTCACCAAAGG
GAAATTGTTCAAGTCTCCAAATGGTGGAAAGAGCTTGGTTTGGCAGAGGA
GTTGAAATTTGCTAGAGACCAACCCCTAAAATGGTACCTCTGGACAGTGG
CAAGTCTACCAGATCCAAGCTTGTCTGAAGAGAGGATTGAACTAACTAAA
CCCATTTCTCTCGTCTACATAATAGATGATATTTTTGATGTTTATGGGAC
ACTAGACGAACTCACTCTTTTCACAGACGCAGTTAATAATTGGGAAATTA
AAGAGCAGTTACCCGACTATTTGAAGATATGTTTCAAGGCACTTGATGAT
ATAACCAACAAAATTAGCTACGTGGTGTACAGAAAACATGGATGGAACCC
AATTGACTCCTTAAGAAAATCGTGGGGAAAACTGTGCAATGCGTTCTTGT
TAGAAGCAGAGTGGTTTGGTTGTGGGAAGTTGCCAAATGAAGAGGAGTAT
TTGAAGAACGCGATTGTGAGTTCTGGTGTACACGTGGTGCTAGTTCATAT
GTTCTTTCTCTTAGGTGAAGGTATATCCATGGAAGCTGTAAACTTACTGG
ACAACATTCCAGGCCTTGTGTCTTCTACAGCAGCAATTCTTCGTCTTTGG
GATGACTTAGGAAGTGCCAAGGATGAGAATCAAAATGGGCATGATGGGTC
TTACGTTGAGTGCTACATGAAAAGACACAAGGAGTGTTCAATGGGCGAAG
CAAGGGAGCAAGTGATTCGTATGATTAAAAATGAGTGGGAACGCCTCAAT
AAGGAGTGTTTCTCGCCAAAACATTTTCCCATGTGCTTCAGAAAGGGTTG
TCTTAATGCTGCTAGGATGGTTCCAGTGATGTATGACTATGATGATCATC
ATCGCCTTCCAAGCCTCCAGAATTATATCAACTCACTTCTC
Sequence Length
1491
Sequence Checksum
badee9f274b297c6e393136763fbe242
Summary
Resource Type
mRNA
Organism
Name
TPS63
Identifier
TPS63
Time Accessioned
Friday, October 21, 2022 - 19:59
Time Last Modified
Friday, October 21, 2022 - 19:59