KY014557.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 125..294
e-value: 5.1E-196
score: 653.9
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 89..268
e-value: 8.2E-47
score: 159.4
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 300..566
e-value: 8.0E-100
score: 333.6
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 88..607
e-value: 5.1E-196
score: 653.9
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 296..624
NoneNo IPR availablePANTHERPTHR31225:SF9coord: 78..623
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 78..623
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..5
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 29..53
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 6..28
NoneNo IPR availableTMHMMTMhelixcoord: 5..27
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 86..294

  • Cannabis sativa isolate Finola_TPS1 terpene synthase mRNA
  • complete cds
Sequences
Sequence
ATGGCTTTTCACCAATTTGCTCCATCATCATCCCTCCCTATTTGGAGTAG
AGTTAATAATCCTTTTACACCAAAAACTTCTATTATTACTTCTATTTCAA
AACCAAAATCAAAACCAAAATCAAACTTGAAATCGAGATCGAAATTGAGA
TCGAGATCAAGATCAAGTACTTGTTACCCCATACAATGTATTGTGATTGA
TAACCCTAGTTCTACGATTATTAATAATAGTGATCGAAGATCGGCCAACT
ATGGACCTCCCATTTGGTCTTTTGATTTTGTTCAATCTCTTCCAATCCAA
TATAAGGGTGAATCATATACAAGTCGATTAAATAAGTTGGAGAAAGATGT
GAAAAGGATGCTAATTGGAGTGGAAAACTCTTTAGCCCAACTTGAACTAA
TTGATACAATACAAAGACTTGGAATATCTTATCGTTTTGAAAATGAAATC
ATTTCTATTTTGAAAGAAAAATTCACCAATAATAATAACAACCCTAATCC
TAATTATGATTTATATGCTACTGCTCTCCAATTTAGGCTTCTACGCCAAT
ATGGATTTGAAGTACCTCAAGAAATTTTCAATAATTTCAAAAATCACAAG
ACAGGAGAGTTCAAGGCAAATATAAGTAATGATATTATGGGAGCATTAGG
CTTATATGAAGCTTCATTCTATGGGAAAAAGGGTGAAAGTATTTTGGATG
AAGCAAGAATTTTCACAACAAAATGTCTCAAAAAATACAAATTAATGTCA
AGTAGTAATAATAATAATATGACATTAATATCATTATTAGTGAATCATGC
TTTGGAGATGCCACTTCAATGGAGAATCACAAGATCAGAAGCTAAATGGT
TTATTGAAGAAATATATGAAAGAAAACAAGACATGAATCCAACTTTACTT
GAGTTTGCCAAATTGGATTTCAATATGGTGCAATCAACATATCAAGAGGA
GCTCAAATTACTCTCTAGGTGGTGGAAGGATTCTAAACTTGGAGAGAAAT
TGCCTTTCGTTAGAGATAGATTGGTGGAGTGTTTCTTATGGCAAGTTGGA
GTAAGATTTGAGCCACAATTCAGTTACTTTAGAATAATGGATACAAAACT
CTATGTTCTATTAACAATAATTGATGATATGCATGACATTTATGGAACAT
TGGAGGAACTACAACTTTTCACTAATGCTCTTCAAAGATGGGATTTGAAA
GAATTAGATAAGTTACCAGATTATATGAAGTCAGCTTTCTACTTTACATA
CAATTTCACAAATGAATTGGCATTTGATGTATTACAAGAACATGGTTTTG
TTCACATTGAATACTTCAAGAAACTGATGGTAGAGTTGTGTAAACATCAT
TTGCAAGAGGCAAAATGGTTTTATAGTGGATACAAACCAACATTGCAAGA
ATATGTTGAGAATGGATGGTTGTCTGTGGGAGGACAAGTTATTCTTATGC
ATGCATATTTCGCTTTTACAAATCCTGTTACCAAAGAGGCATTGGAATGT
CTAAAAGACGGTCATCCTAACATAGTTCGCCATGCATCGATAATATTACG
ACTTGCAGATGATCTAGGAACATTGTCGGATGAAATGAAAAGAGGCGATG
TTCCTAAATCAATTCAATGTTATATGCACGATACTGGTGCTTCTGAAGAT
GAAGCTCGTGAGCACATAAAATATTTAATAAGTGAATCATGGAAGGAGAT
GAATAATGAAGATGGAAATATTAACTCTTTTTTCTCAAATGAATTTGTTC
AAGTTTGCCAAAATCTTGGTAGAGCGTCACAATTCATATACCAGTATGGC
GATGGACATGCTTCTCAGAATAATCTATCGAAAGAGCGCGTTTTAGGGTT
GATTATTACTCCTATCCCCATGTAA
Sequence Length
1875
Sequence Checksum
4d34f9620dd4b02ca96793b4774f4d66
Summary
Resource Type
mRNA
Accession
KY014557.1
Organism
Name
KY014557.1
Identifier
KY014557.1
Time Accessioned
Friday, October 21, 2022 - 19:59
Time Last Modified
Friday, October 21, 2022 - 19:59