KY014556.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR001906Terpene_synth_N
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR036965Terpene_synth_N_sf

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..32
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 33..38
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..19
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 20..39
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 40..41
NoneNo IPR availableCOILSCoilCoilcoord: 349..369
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 6..549
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 6..549
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 65..222
e-value: 3.6E-191
score: 637.9
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 28..533
e-value: 3.6E-191
score: 637.9
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 223..551
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 228..493
e-value: 2.8E-103
score: 344.9
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..197
e-value: 1.1E-51
score: 175.3
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 25..223

  • Cannabis sativa isolate Finola_TPS8 terpene synthase mRNA
  • complete cds
Sequences
Sequence
ATGTCAAATATTCAAGTCTTAGCTTCATCTCAATTATGTGACAAAATTAT
TGCTCGCCCAACAACAAAATTTCACCCTTCTATTTGGGGTGATCGATTCC
TCCATTACAATATTTCAGAACAAGACTTGGTTTGCAAACAAGAAAGAGTT
GAAGAATTAATACAAGTTGTAAAGAAAGAGATATTATCTTCAAATCATGA
TCAATTGAAGTTGATTGACAATCTCCAACGTTTGGGATTATCATATCATT
TCGAGAGTGAAATCGAGAAATTATTGGAACAATTAAGTATCGGCACTCAT
CATCAAAATAATAATCTACATGATGTTTCTCTTCGGTTCAGACTATTAAG
ACAAAGTGGATTTAAGGTTTCATCAAGCATATTTGAAAAATTCAAAGACG
AGAAAGGTAACTTTAAAGAAAGCCTAATAACCGATGTTTCAGGTTTGCTT
AGCTTGTATGAGGCTTCGCACTTGAGTTATGTTGGAGAAAGCATACTAGA
TGAAGCACTTGCTTTCACAACCACTCACCTTAAGGCTATTGTGGCAAATA
GTAAAGATCATCCATTATCACATCAAATATCCAAAGCATTGGAAACGCCA
TTAAGAAAGACCATAGAGAGGCTTCATGCTAGGTTTTACATCTCAATCTA
TGAAAAGGATGCCTCTCATAACAAACTATTGCTAGAGCTTGCAAAGTTAG
ACTTCAATGTACTTCAATGTTTCCACAAAAAGGAACTTAGTGAAATTATG
AGGTGGTGGAAGGAGCATGAGTTTGTAAAGAAATTCCCTTTTGCAAGAGA
TAGGATGGTGGAACTGTATTTTTGGATATTGGGTGTATATTATGAACCCA
AATACTCTCGAGCAAGAAAGCTTTTGACCAAAGTCATTGCATTGACCTCA
ATCACTGATGATACTTATGATGCATATGGTACTATTGATGAGCTTGAGCT
TCTTACCAAAGCAATTCAAAGGTGGGACATAAATTGTATGGATAAACTTG
AGCCAGAATATTTAAGGACATATTATAAGGTAATGTTGGAATCTTATGAA
GAATTTGAAAAGGAGCTTAAAAAGGAAGAATTATACAAACTCGAGTATGC
AAAAGAAGAGATGAAAAGAATTATTAGAGCTTATTTTGAAGAAGCTCGAT
GGTTGAATGAAGGATATTTGCCAAGGTTGGATGAGCATTTGAGAGTTTCA
TATGTTTCTTGTGGTTACGTTATGTTGATAGCCACAAGTTATGTAGGAAT
GCATGATATTGTAACACATGAAACTCTAGATTGGCTCTCTAAAGACCCTA
AGATTATTTCAGCTTCCACTCTCCTATCAAGATTCATGGATGACATAGGC
TCTCGCAAGTTTGAGCAAGAGAGAAATCACATACCATCTACAGTGGATTG
TTACATGAAACAATATGGAGTATCAGAGGAAGAGGCAATTAAAGAACTTA
ATAAAAGAGTGGTCACCTACTGGAAAGAAATCAATGAAGACTTTATTAGG
CCAACTGTTGTGCCTTTTCCTATCTTAGTTCGTGTTCTTAATTTTACAAA
AGTAATAGATCTCTTTTACAAAGAGGGTGATGATCAATACACACGTGTTG
GAAAAGCGCTCAAAGAAAGCATTGATGCTTTGCTTATAGATTCAATCCCA
TTATAA
Sequence Length
1656
Sequence Checksum
74e257d287f5a31ea0bf540222bf6b9c
Summary
Resource Type
mRNA
Accession
KY014556.1
Organism
Name
KY014556.1
Identifier
KY014556.1
Time Accessioned
Wednesday, October 19, 2022 - 15:47
Time Last Modified
Wednesday, October 19, 2022 - 15:47