KY014555.1

Annotations
This record has the following annotations.
TermNameDefinition
GO:0000287magnesium ion bindingInteracting selectively and non-covalently with magnesium (Mg) ions. [GOC:ai]
GO:0016829lyase activity
GO:0010333terpene synthase activityCatalysis of the formation of cyclic terpenes through the cyclization of linear terpenes (e.g. isopentenyl-PP, geranyl-PP, farnesyl-PP and geranylgeranyl-PP) containing varying numbers of isoprene units. [EC:4.2.3.-, GOC:tair_curators]
INTERPRO:IPR008930Terpenoid_cyclase/PrenylTrfase
INTERPRO:IPR036965Terpene_synth_N_sf
INTERPRO:IPR008949Isoprenoid_synthase_dom_sf
INTERPRO:IPR005630Terpene_synthase_metal-bd
INTERPRO:IPR001906Terpene_synth_N

Click a tab below to view blast alignments.

IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..47
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 70..78
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 48..69
NoneNo IPR availableSUPERFAMILY52058L domain-likecoord: 1..68
NoneNo IPR availableTMHMMTMhelixcoord: 45..67
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 32..57
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..31
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 10..31
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..32
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 33..62
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 13..30
NoneNo IPR availablePANTHERPTHR31225FAMILY NOT NAMEDcoord: 13..566
NoneNo IPR availablePANTHERPTHR31225:SF42coord: 13..566
NoneNo IPR availablePHOBIUSTRANSMEMBRANETransmembrane regioncoord: 12..36
NoneNo IPR availablePHOBIUSNON_CYTOPLASMIC_DOMAINNon cytoplasmic domaincoord: 37..49
NoneNo IPR availablePHOBIUSCYTOPLASMIC_DOMAINCytoplasmic domaincoord: 1..11
NoneNo IPR availableTMHMMTMhelixcoord: 13..35
IPR001906Terpene synthase, N-terminal domainPFAMPF01397Terpene_synthcoord: 29..213
e-value: 5.5E-54
score: 182.8
IPR005630Terpene synthase, metal-binding domainPFAMPF03936Terpene_synth_Ccoord: 244..511
e-value: 1.1E-102
score: 343.0
IPR008949Isoprenoid synthase domain superfamilyGENE3D1.10.600.10coord: 29..550
e-value: 6.7E-185
score: 617.3
IPR008949Isoprenoid synthase domain superfamilySUPERFAMILY48576Terpenoid synthasescoord: 239..566
IPR036965Terpene synthase, N-terminal domain superfamilyGENE3D1.50.10.130coord: 68..238
e-value: 6.7E-185
score: 617.3
IPR008930Terpenoid cyclases/protein prenyltransferase alpha-alpha toroidSUPERFAMILY48239Terpenoid cyclases/Protein prenyltransferasescoord: 26..239

  • Cannabis sativa isolate Finola_TPS9 terpene synthase mRNA
  • complete cds
Sequences
Sequence
ATGTCCACTCAAATCTTAGCAACCTCATTTAAAAATGACAATATACATAA
AATTGTTCGGCCAACAACAAATTATCATCCTTCTATTTGGGGAGACCGAT
TTTTGCATTACGATATTCCAAAAGAAGAATTGAATTATAAACAAGGCCAA
GTTGAAGAATTGAAAGAAGTGGTAAGAAAGGAGATATTTGGAGAATTCTT
ATGTGATGATTGGAATAATCGATTGAAGTTAATTGATGTGGTAGAACGTT
TGGGATTGTCCTATCATTTTGAGAGTGAAATACAAAATGAGCTTCAACAC
ATTTACAACAAAATAAGCATTAATGATTCTAATTTCAAACATGAAACTTT
GCATGATGCTTCTATTCGGTTTAGACTTCTACGACAACATGGATATAGGG
TTTCTTTAGATATATTTGACAAGTTCAAAGATGAGAATGGCAACTTTAAA
GAATGTTTGGCGAGTGACACCGTTGGTTTGCTTAGCTTATATGAGGCCTC
ACATTTGAGCTGTGTTGGAGAAAATTTACTAGATGAAGCCCTTTCTTTCA
CTACCAAACACCTAACTGAATTTTTGGAAAATAATAAAAAAGAACACCCC
AATGATGATCCATTATCAAAGGAAATATCTCGAGCCCTAGAGAGGCCCTT
AAGAAAGACCCTAGTGAATCTCCATGCAAGGTATTTCATTTCAATATATG
AAAAAGATGCCTCACATAACAAAGTATTGCTACAACTTGCAAAGTTAGAT
TTCAATCTATTACAATCCATGCACAAAAAGGAGCTTAGTGAAATCTCAAG
GTGGTGGAAGGAATTAGACAGTGCACACAACTTTCCATTTGCAAGAAATA
GGATTGTGGAACTGTACATTTGGATATTAGGAGTCTATTATGAACCCCAA
TACTCTTTTGCAAGAAATATTTTAGTGAAGATCATAGCACTTTCCTCAAT
CGCTGATGATATTTATGATTCATATGGTATATTTGAAGAACATAAGCTCC
TTATTGAAGCAATTGATAGGTGGGACAAAAATTGTATGGATAAACTCCAT
CCAGAATACTTGCAGAAATATTATAAGATACTTTTGCAATCTTTTGAGGA
ATTTGAACAAGAGTTTGAAAAGGAGGAAACTTACAAAGTTTACTATGGAA
AAGAAACGTTTAAAAGATTATTAAAAGGTTATTTTGAAGAAGCTCGATGG
TTGAATGAAGGATACATGCCAAGTTTGGAGGAGCATTTAAAAGTTTCTTT
GGTTACATCTGGTTATTTCATGTTGATGGCTTGCTCTTTAGTTGGAATGA
AAAGTAACAATATTGTAACCAAACAAGTTTTCGAGTGGCTCTCCAAAGAC
CCCAAGATTGTTAGGGCAAGCGCTAGTGTTTGCAGGTACATGGATGACGT
GGCTGGTCACAAGAATGAGCAAGAGAGAAATCATATACCATCTACAATAG
AATGTTACATGAAGCAATATGGTGTATCAGAAGAAGAAGCATGTGATGAA
ATGAATAGGCGAGTGGTTATTGCATGGAAAGAAATAAACGAAGAGTTTCT
CAAACCAACTGAAGCAGCTTCACCTATATTAGTTCGTGCTCTGAATCTTG
CTAGGGTTATGGATCTTCTCTACAAAAATGGTGATAACTATACACAAGTT
GGAAAAGTCACTAAAGATAGCGTTGCTGTCTTGCTCATTGATCCAATTCC
ATAA
Sequence Length
1704
Sequence Checksum
2470e5cb2a89d88d29edef94c6d0c6b8
Summary
Resource Type
mRNA
Accession
KY014555.1
Organism
Name
KY014555.1
Identifier
KY014555.1
Time Accessioned
Friday, October 21, 2022 - 19:58
Time Last Modified
Friday, October 21, 2022 - 19:58